klinika weterynaryjna warszawa bielany cd

Komórki HeLa inkubowane z E. coli HB101 nie mają żadnych agregatów aktyny (panel F, × 635). Izolat dróg moczowych zidentyfikowano jako serotyp E. coli O103: H2 (Figura 1A, Figura 1B, Figura 1C, Figura 1D, Figura 1E, Figura F. Ten wyizolowany fermentowany sorbitol po wysianiu na agarze z Sorbitolem MacConkeya, jest hemolityczny15 i cytotoksyczny dla Vero komórki 16 przylegają do komórek HeLa w zlokalizowanym wzorze (Figura 1B) i indukują agregację aktyny w komórkach, do których przylega (Figura 1E) .7,17 Ten szczep nie aglutynuje perełek galaktozy. ludzkie erytrocyty, 18,19, ani nie posiada sekwencji homologicznych do operonu pap lub rodziny adhezyn rozpoznających receptor Dr.
Zakażający szczep zawiera stx1, kodujący toksynę Shiga 1, o czym świadczy hybrydyzacja Southern w ostrych warunkach21 sondy stx122 do fragmentu EcoRI 9 kb bakteryjnego DNA. Sonda stx222 (kodująca toksynę Shiga 2) nie hybrydyzowała z sekwencjami w bakteryjnym DNA. Ponadto, startery specyficzne dla stx1 (5 GAAGAGTCCGTGGGATTACG3 i 5 AGCGATGCAGCTATTAATAA3 ) zamplifikowały fragment 130 par zasad, podczas gdy startery specyficzne wobec stx2 (5 TTAACCACACCCACGGAGT3 i 5 GCTCTGGATGCATCTCTGGT3 ) nie były w stanie powielić żadnych sekwencji stx2. hybrydyzacja wykazała również, że ten szczep E. coli O103: H2 posiada eaeA, kodujący intimin, 24 a białko bakteryjne, które pośredniczy w usuwaniu enterocytów przez przyłączone enteropatogenne E. coli.
Dyskusja
Szczep E. coli O103: H2 wytwarzający toksynę Shiga odzyskiwano z moczu sześcioletniej dziewczynki na dzień przed pojawieniem się pierwszych dowodów laboratoryjnych na zespół hemolityczno-mocznicowy. Ponieważ nie było wcześniej biegunki, jest prawdopodobne, że wytwarzające toksynę E. coli O103: H2 wytwarzające toksynę Shiga wytwarzają wchłoniętą toksynę, która wytrąca syndrom. Biegunka, która zaczęła się w tym samym czasie co zmiany mikroangiopatyczne obserwowano w rozmazie krwi, była bardziej prawdopodobnym efektem ubocznym antybiotyku o szerokim spektrum działania w leczeniu infekcji dróg moczowych niż zakażenia żołądkowo-jelitowego z powodu toksyny Shiga. produkując E. coli. Demonstracja E. coli wytwarzających toksynę Shiga w układzie moczowym przy braku bakteriemii lub biegunki przed wystąpieniem zespołu hemolityczno-mocznicowego sugeruje, że ludzki błony śluzowej, podobnie jak błona śluzowa żołądka i jelit, może umożliwić wchłanianie toksyny Shiga Ultrasonografia i cystouretrografia mikcji nie ujawniły żadnych anomalii anatomicznych, które predysponowałyby pacjenta do zastoju w moczu. Jednak możliwy ropień w dolnym biegunie lewej nerki mógł zapewnić portal wejścia dla toksyny. Chociaż jest mało prawdopodobne, biorąc pod uwagę kolejność zdarzeń, nie możemy całkowicie wykluczyć z przewodu pokarmowego źródła zaabsorbowanej toksyny, ponieważ analiza mikrobiologiczna kału w drugim dniu szpitalnym nie wykryłaby fermentacji sorbitu E. coli O103: H2, ponieważ nie wykonano oznaczeń toksyczności Shiga w kale ani analizy odzyskanej E. coli pod kątem toksyczności.
Przypadek ten pokazuje, że zespół hemolityczno-mocznicowy może być wywołany przez E wytwarzający toksynę Shiga
[więcej w: rak plaskonablonkowy, dabrafenib, busulfan ]
[więcej w: słońce ciekawostki, rak plaskonablonkowy, rak podstawnokomórkowy rokowania ]