paznokcie u nóg żelowe ad

Waga przy urodzeniu wynosiła 3480 g, długość wynosiła 49 cm, stosunek segmentu górnego do dolnego wynosił 1,54 (wartość normalna przy urodzeniu, 1,70), a obwód głowy 34,5 cm. Niemowlę miało tachypnea i sinicę z powodu mikrognatii, które ustępowały w wyniku intubacji w jamie ustnej. Poza wyraźnym ukłonem obu kości udowych nie odnotowano żadnych innych nieprawidłowości podczas badania fizykalnego. Po urodzeniu i 3 dniu stężenia wapnia i fosforu w surowicy niemowlęcia były prawidłowe dla jej wieku, ale aktywność fosfatazy alkalicznej w surowicy wynosiła 385 jednostek na litr (normalny zakres dla tego wieku, od 73 do 264). Badania radiograficzne wykazały zbijanie się i nieregularność wszystkich kości długich, oznaczały korowe spustoszenia ze słabą definicją kory kostnej i znaczącą resorpcję podokostnową. Występowały obustronne złamania kości piszczelowej, czaszka była osłabiona, a żuchwa była niedorozwój. W wieku sześciu miesięcy stężenie wapnia w surowicy pacjenta mieściło się w zakresie od 11,8 do 12,4 mg na decylitr (2,95 do 3,10 mmol na litr), stężenie fosforu wahało się od 2,8 do 3,6 mg na decylitr (0,9 do 1,2 mmol na litr), oraz stężenie PTH wynosiło 0,2 .l-eq na mililitr (normalny zakres, 2,4 do 5,9). Żadne inne badania laboratoryjne nie były wykonywane przed 1995 rokiem. W wieku 1/2 lat pacjent przeszedł przedni postęp orbitalny w kierunku synostozy bikoralnej.
W 1995 roku, w wieku 12 lat, wzrost pacjenta wynosił 104 cm (36 cm poniżej piątego centyla), a jej waga wynosiła 27 kg (4 kg poniżej piątego centyla). Jej włosy łonowe i rozwój piersi były odpowiednio stadium 2 i 3 Tannera. Miała nieprawidłowości charakterystyczne dla chondrodysplazji metajęzykowej Jansena, w tym asymetrię czołowo-oczodołową, hiperteloryzm i niedorozwój żuchwy. Jej skóra była sucha i łuszcząca się, a jej włosy były cienkie. Była uczennicą B w odpowiedniej klasie wiekowej.
Wartości laboratoryjne były następujące: stężenie wapnia w surowicy, 11,2 do 11,5 mg na decylitr (2,80 do 2,87 mmol na litr); stężenie fosforu, 2,0 do 3,1 mg na decylitr (0,6 do 1,0 mmol na litr); Stężenie PTH, <0,4 pg na mililitr; Stężenie PTHrP, <5 pmol na litr; stężenie osteokalcyny, 97 ng na mililitr (skorygowany w zależności od wieku, 8 do 18); specyficzna dla kości aktywność fosfatazy alkalicznej, 319 U na litr (normalny zakres dostosowany do wieku, 10 do 50); Stężenie 25-hydroksywitaminy D, 14 ng na mililitr (35 nmoli na litr); i stężenie 1,25-dihydroksywitaminy D, 42 pg na mililitr (101 pmol na litr).
Identyfikacja mutacji
Wszystkie kodujące egzony genu kodującego receptor PTH-PTHrP amplifikowano z genomowego DNA krwi leukocytowej przy zastosowaniu reakcji łańcuchowej polimerazy (PCR). Produkty analizowano za pomocą elektroforezy żelowej z gradientem temperatury lub bezpośredniej analizy sekwencji nukleotydów
Zmiany nukleotydowe, które powodują mutację H223R w eksonie M2 i mutację treonina-prolina w eksonie M6 / 7 (reszta 410 receptora PTH-PTHrP) zostały potwierdzone przez trawienie enzymem restrykcyjnym. W tym celu, mniejsze fragmenty egzonu amplifikowano za pomocą PCR z użyciem różnych primerów odwrotnych od wcześniej opisanych.21 Starter odwrotny dla eksonu M2, 5 CTCCTCCTCGGTGAGGCGCTCA3 , który zsyntetyzowano za pomocą zacisku GC, 21 wygenerował 206 -bp produkt PCR; jeśli adenina w pozycji 696 została zmutowana na guanozynę, trawienie enzymem restrykcyjnym za pomocą Sph I dało dwa fragmenty DNA o długości 58 i 148 pz
[przypisy: bimatoprost, wdrożenia magento, Enterolbuprenorfina ]
[podobne: rumień brzeżny, rwa barkowa leczenie, rwa ramienna objawy ]