paznokcie u nóg żelowe cd

Odwrotny starter dla eksonów M6 / 7, 5 GTCCCTGAGACCTCGGTGTAT3 wytworzył produkt PCR o wielkości 135 bp. Trawienie enzymem restrykcyjnym za pomocą Aci I dało w wyniku dwa fragmenty DNA o długości 30 i 105 pz; jeśli adeninę w pozycji 1256 zmutowano do cytozyny, Aci I strawiło fragment 105-bp w fragmentach 28- i 77-bp. Mutację H223R potwierdzono również za pomocą analizy Southern blot genomowego DNA In Vitro Ocena receptorów PTH-PTHrP dzikiego typu i zmutowanych
Mutacje wprowadzono do komplementarnego DNA kodującego ludzki receptor PTH-PTHrP typu dzikiego (HKrk) i wersję receptora zawierającego znacznik epitopu hemaglutyniny ludzkiego wirusa 16. Plazmidowy DNA z co najmniej dwóch niezależnych kolonii bakteryjnych, z których każdy koduje odpowiedni zmutowany receptor PTH-PTHrP ulegał ekspresji w komórkach COS-7.
Syntezy bydlęcego PTH (1-34) amidu i [Tyr36] ludzkiego PTHrP (1-36) bydlęcego PTH (1-34) amidu, testy radioreceptorów, badania akumulacji wywołanych przez PTH i PTHrP cyklicznych AMP i fosforanu inozytolu, syntezy [Nle8, Nle18, Tyr34] bydlęcego PTH (1-34); a badania wiązania antyhemaglutyniny przeprowadzono w sposób opisany w innym miejscu [16,21]
Wyniki
Figura 2. Figura 2. Analiza genomowego DNA od pacjentów z chondrodysplazją jenysenowską i mutacją H223R w receptorze PTH-PTHrP. Produkty PCR amplifikowano zgodnie z opisem w sekcji Metody i trawiono SphI przed elektroforezą za pomocą 3% żelu MetaPhor (FMC Bioproducts, Rockland, Me.) I barwienia bromkiem etydyny. Kwadraty oznaczają męskich członków rodziny i okręgi członków rodziny płci żeńskiej. Członkowie nienaruszeni są oznaczani symbolami otwartymi, a członkowie atakowani – symbolami półstałymi.
Niedawno donieśliśmy o identyfikacji heterozygotycznej mutacji H223R genu dla receptora PTH-PTHrP u pacjenta z chondrodysplazą metapoetyczną Jansena (Pacjent 1, Tabela i Figura 2), który skutkuje konstytutywną, niezależną od liganda akumulacją cyklicznego AMP in vitro .16 Ta mutacja jest spowodowana przejściem adeniny do guaniny, które wprowadza nowe miejsce restrykcyjne Sph I w eksonie M2 genu dla receptora PTH-PTHrP. Powielony metodą PCR genomowy DNA od sześciu dodatkowych pacjentów z biochemicznymi lub radiologicznymi dowodami na chorobę Jansena został w pierwszej kolejności zbadany przez trawienie Sph I. Produkty PCR od dotkniętych pacjentów w rodzinach 1, 2 i 3 dały, oprócz niestrawionego produktu PCR, fragmenty DNA o 58 i 148 pz (Figura 2). Zmiana heterozygotycznej adeniny na guaninę została potwierdzona przez bezpośrednią analizę sekwencji nukleotydów i analizę Southern biot genomowego DNA strawionego Sph I (dane nie pokazane). Mutacja ta nie została wykryta u krewnych pierwszego stopnia u pacjentów z rodzin i 2 (ryc. 2), u trzech innych uprzednio opisanych pacjentów z chondrodysplazją przyśrodkową Jansena (pacjenci 4, 5 i 6) lub u 45 osób zdrowych ( dane nie pokazane). W rodzinie 3 wykryto mutację H223R u chorej matki (pacjent 3A) i jej chorej córki (pacjent 3B), ale nie u zdrowego ojca.
Figura 3. Figura 3. Identyfikacja mutacji T410P w receptorze PTH-PTHrP. Panel A pokazuje wyniki bezpośredniej analizy sekwencji nukleotydowej egzonu M6 / 7 amplifikowanego PCR genu receptora PTH-PTHrP od normalnego osobnika (normalny) i pacjenta 4 (zmutowany).
[podobne: Enterolbuprenorfina, Mimośród, bimatoprost ]
[więcej w: prohormony skutki uboczne, przedawkowanie witaminy b12, przełyk barretta dieta ]