Wirusowe zapalenie wątroby związane z zapaleniem wątroby typu C ad

Aby wykluczyć możliwość koinfekcji HBV i wirusem zapalenia wątroby typu G (HGV), wszystkie próbki surowicy badano pod kątem obecności DNA HBV i RNA HGV w reakcji łańcuchowej polimerazy (PCR), a wszystkie były ujemne. Metody
Testowanie anty-HCV
Testy immunoenzymatyczne pierwszej i drugiej generacji (Ortho Diagnostic Systems, Raritan, NJ) zostały użyte do testowania anty-HCV.
Wykrywanie, miareczkowanie, genotypowanie i sekwencjonowanie RNA HCV
Całkowity RNA wyekstrahowany z 100 .l surowicy metodą izotiocyjanianu guanidyny-fenolu-chloroformu18 amplifikowano za pomocą PCR z dwoma zestawami zagnieżdżonych starterów. Pierwszy zestaw, pochodzący z regionu niekodującego 5 19, zastosowano do zbadania przebiegu wiremii HCV, a drugi zestaw z genów E1 i E2, 19 obejmujący region hiperzmienny 1,20, zastosowano do określenia genotypu HCV21 oraz stopień zmienności w poszczególnych izolatach wirusa. Czułość i swoistość tego testu zagnieżdżonego PCR zostały wcześniej opisane18. Stężenie HCV RNA w surowicy mierzono testem DNA z rozgałęzionym łańcuchem za pomocą testu Amplex Chiron (Chiron, Emeryville, CA).
Produkty PCR pochodzące z regionów E1 i E2 analizowano zarówno przez bezpośrednie sekwencjonowanie, jak opisano wcześniej, 19 i przez sekwencjonowanie klonów molekularnych. Zamplifikowane produkty PCR również wklonowano do systemów wektora pGEM-T (Promega Biotech, Madison, Wis.) I 8 do 10 klonów z każdej próbki zsekwencjonowano za pomocą zautomatyzowanego sekwenatora DNA (model 373, Applied Biosystems, Foster City, CA. ) zmodyfikowaną metodą Sangera.
Wykrywanie RNA wirusa HGV w surowicy
Całkowity RNA wyekstrahowany ze 100 .l surowicy amplifikowano za pomocą PCR ze starterami pochodzącymi z przypusz- czalnego piątego niestrukturalnego regionu genomu HGV, jak opisano uprzednio23. Produkty PCR analizowano przez hybrydyzację dot blot z sondą oligonukleotydową znakowaną 32P. 23
Wykrywanie DNA wirusa HBV w surowicy
DNA HBV surowicy ekstrahowano, 24 i przeprowadzono PCR z zagnieżdżonymi starterami pochodzącymi z genu preS1 i głównego genu S genomu HBV. Zewnętrzna para primerów składała się z F1 (5 GGGTGGAGCCCTCAGGCTCAGGGCA3 ), rozpoczynając od pozycji mapy 1679 i F2 (5 GAAGATGAGGCATAGCAGCAGGAT3 ), rozpoczynając od pozycji 2254 mapy. Wewnętrzna para primerów składała się z F3 (5 CCTCCTGCCTCCACCAAT3 ), rozpoczynając w pozycji mapy 1730 i F4 (5 GAGGTTGGTGGTGAGTGATTG3 ), rozpoczynając od pozycji mapy 2166.
Badania biopsyjne wątroby i barwienie immunohistochemiczne w celu wykrycia antygenu HCV w wątrobie
Tkanka wątroby uzyskana podczas autopsji została wybarwiona na antygen HCV kodowany przez czwarty gen niestrukturalny (ns4); określono procent komórek, które były antygenowo pozytywne. Oddzielone skrawki tkanek wstępnie traktowano roztworem proteazy XXIV i płukano w buforze TRIS-kwas chlorowodorowy. Skrawki inkubowano przez 30 minut z mysim przeciwciałem monoklonalnym przeciwko białku eksprymowanym z regionu NS4 genomu HCV (MA 292, Biogenex, San Ramon, CA). Skrawki przemywano, a następnie inkubowano z biotynylowanym przeciwciałem antymaterii (HK 335-5K, Biogenex) przez 30 minut. Próbki płukano i stosowano znacznik streptawidyna-fosfataza (HK 331-5K, Biogenex), a następnie płukano i nakładano roztwór 6-bromo-2-hydroksy-3-naftolowego niebieskiego substratu.
[przypisy: teosyal, busulfan, Mimośród ]
[przypisy: nieżyt nosa krzyżówka, przetoka odbytu objawy, przetoka odbytu zdjęcia ]